ID: 1123053277_1123053293

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1123053277 1123053293
Species Human (GRCh38) Human (GRCh38)
Location 14:105557875-105557897 14:105557919-105557941
Sequence CCTTTGGGCAGAAGAAGCCCTTG CGCGGGGCTGCGCTCGGGCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 17, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!