ID: 1123053282_1123053289

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1123053282 1123053289
Species Human (GRCh38) Human (GRCh38)
Location 14:105557893-105557915 14:105557914-105557936
Sequence CCTTGTGGGAGCCTCGGTCCAGC GCCTCCGCGGGGCTGCGCTCGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 12, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!