ID: 1123117390_1123117396

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1123117390 1123117396
Species Human (GRCh38) Human (GRCh38)
Location 14:105900844-105900866 14:105900859-105900881
Sequence CCGCCCCGGTGTGTGGGGTGGGC GGGTGGGCCCAGGACTCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 26, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!