ID: 1123220581_1123220590 |
View in Genome Browser |
Spacer: 8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1123220581 | 1123220590 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 14:106851642-106851664 | 14:106851673-106851695 |
Sequence | CCCACTTGAATTTGCATAGTTGC | CCTGAAGGGAAGAGTCTACAAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |