ID: 1123223424_1123223429

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1123223424 1123223429
Species Human (GRCh38) Human (GRCh38)
Location 14:106877858-106877880 14:106877880-106877902
Sequence CCAGCCACTGACTGTGTAAAAGG GTGGCTGCTTTCTTTGTCCAGGG
Strand - +
Off-target summary No data {0: 5, 1: 8, 2: 4, 3: 25, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!