ID: 1123223424_1123223430

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1123223424 1123223430
Species Human (GRCh38) Human (GRCh38)
Location 14:106877858-106877880 14:106877895-106877917
Sequence CCAGCCACTGACTGTGTAAAAGG GTCCAGGGCTCAGACTTTCCTGG
Strand - +
Off-target summary No data {0: 4, 1: 7, 2: 7, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!