ID: 1123402517_1123402527

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1123402517 1123402527
Species Human (GRCh38) Human (GRCh38)
Location 15:20002759-20002781 15:20002802-20002824
Sequence CCTTATATTTATGGTAAAAGGCA CATGGTGAGCAGGGGGAAGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 6, 3: 67, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!