ID: 1123434679_1123434689

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1123434679 1123434689
Species Human (GRCh38) Human (GRCh38)
Location 15:20246609-20246631 15:20246649-20246671
Sequence CCACCTCAGCCTCCCAAAGTGCT CCACCACACCCAGCCAAGGAAGG
Strand - +
Off-target summary {0: 60215, 1: 147830, 2: 155736, 3: 113395, 4: 79914} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!