ID: 1123492056_1123492063

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1123492056 1123492063
Species Human (GRCh38) Human (GRCh38)
Location 15:20788677-20788699 15:20788704-20788726
Sequence CCTGATATTCTCTGTGATAGAGG AGCCCTCCTCAGAGACCCGGGGG
Strand - +
Off-target summary {0: 3, 1: 8, 2: 3, 3: 8, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!