ID: 1123557869_1123557877

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1123557869 1123557877
Species Human (GRCh38) Human (GRCh38)
Location 15:21451780-21451802 15:21451814-21451836
Sequence CCTATGGCTCGCCTCCACCGGCC TGAGCTCTGCGTGCGCCCGGCGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 9, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!