ID: 1123716693_1123716697

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1123716693 1123716697
Species Human (GRCh38) Human (GRCh38)
Location 15:23039133-23039155 15:23039156-23039178
Sequence CCGGCCGGCAAGAAACCCAGTTC ACGCTTTCCCCGTGACGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64} {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!