ID: 1123716693_1123716702

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1123716693 1123716702
Species Human (GRCh38) Human (GRCh38)
Location 15:23039133-23039155 15:23039168-23039190
Sequence CCGGCCGGCAAGAAACCCAGTTC TGACGATCAGGACGCGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64} {0: 1, 1: 0, 2: 0, 3: 3, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!