|
Left Crispr |
Right Crispr |
| Crispr ID |
1123904138 |
1123904146 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:24905334-24905356
|
15:24905385-24905407
|
| Sequence |
CCCTGTCTCTACTAAATATACAA |
TGTAGTCTTAGCAGCTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 482, 1: 65216, 2: 161992, 3: 186495, 4: 117003} |
{0: 2, 1: 17, 2: 572, 3: 8470, 4: 70355} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|