ID: 1124014219_1124014231

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1124014219 1124014231
Species Human (GRCh38) Human (GRCh38)
Location 15:25862606-25862628 15:25862652-25862674
Sequence CCTGCGCCACCGCGCGCTCGCTC TGAAGACCAGGCAGCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199} {0: 1, 1: 1, 2: 1, 3: 28, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!