ID: 1124136172_1124136177

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124136172 1124136177
Species Human (GRCh38) Human (GRCh38)
Location 15:27038107-27038129 15:27038130-27038152
Sequence CCCATCTCAGTCCGGTTGGCCAC TGTAACAAATACCTTAGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77} {0: 1, 1: 5, 2: 50, 3: 227, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!