ID: 1124186010_1124186015

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124186010 1124186015
Species Human (GRCh38) Human (GRCh38)
Location 15:27530173-27530195 15:27530208-27530230
Sequence CCTGGGGCAAGCTGTTCCAATTG TTCCTAACATGTCAAATGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110} {0: 1, 1: 0, 2: 2, 3: 21, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!