ID: 1124349968_1124349974

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124349968 1124349974
Species Human (GRCh38) Human (GRCh38)
Location 15:28948062-28948084 15:28948097-28948119
Sequence CCATCCAGAGAGGTGATGATGTG TATAGAGTCTACTGTTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168} {0: 1, 1: 0, 2: 1, 3: 7, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!