ID: 1124349970_1124349974

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1124349970 1124349974
Species Human (GRCh38) Human (GRCh38)
Location 15:28948066-28948088 15:28948097-28948119
Sequence CCAGAGAGGTGATGATGTGGTTA TATAGAGTCTACTGTTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141} {0: 1, 1: 0, 2: 1, 3: 7, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!