ID: 1124396812_1124396817

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1124396812 1124396817
Species Human (GRCh38) Human (GRCh38)
Location 15:29309464-29309486 15:29309490-29309512
Sequence CCCTGGCTTTCTTCTCTATAGAA GCTCAGTGGGCCAAGCACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 586} {0: 1, 1: 0, 2: 9, 3: 76, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!