ID: 1124618129_1124618134

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1124618129 1124618134
Species Human (GRCh38) Human (GRCh38)
Location 15:31257177-31257199 15:31257202-31257224
Sequence CCAGGAAGCCCTCACCAGACACT TTCTGCTGGTACCTTGATTTTGG
Strand - +
Off-target summary {0: 5, 1: 7, 2: 23, 3: 46, 4: 361} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!