ID: 1124650383_1124650391

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124650383 1124650391
Species Human (GRCh38) Human (GRCh38)
Location 15:31469551-31469573 15:31469594-31469616
Sequence CCTTGTCCAGGAGGGCGGGGCTC GAGGCCTGGGTCTGCAGCTGTGG
Strand - +
Off-target summary No data {0: 20, 1: 18, 2: 85, 3: 151, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!