ID: 1124696664_1124696677

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1124696664 1124696677
Species Human (GRCh38) Human (GRCh38)
Location 15:31870011-31870033 15:31870056-31870078
Sequence CCACGCAGTCACAGCTCCGGTGC GCTCGGGGCCGGGCCCTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 73} {0: 1, 1: 0, 2: 7, 3: 47, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!