ID: 1124881130_1124881132

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1124881130 1124881132
Species Human (GRCh38) Human (GRCh38)
Location 15:33643895-33643917 15:33643908-33643930
Sequence CCAAGTCATTCTTTAGGCTCACT TAGGCTCACTGCATTGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144} {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!