ID: 1124953310_1124953314

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124953310 1124953314
Species Human (GRCh38) Human (GRCh38)
Location 15:34343042-34343064 15:34343082-34343104
Sequence CCCTGCTCGTTGAGGTAATACTG ATAAGCCAGCGGTCCCAATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37} {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!