ID: 1125149845_1125149850

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1125149845 1125149850
Species Human (GRCh38) Human (GRCh38)
Location 15:36519281-36519303 15:36519315-36519337
Sequence CCCAGGAGACAGAGGTGGCAGTG TACCACTGCACTCCAGCTTAGGG
Strand - +
Off-target summary {0: 20, 1: 2044, 2: 34806, 3: 109568, 4: 171551} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!