ID: 1125149846_1125149850

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1125149846 1125149850
Species Human (GRCh38) Human (GRCh38)
Location 15:36519282-36519304 15:36519315-36519337
Sequence CCAGGAGACAGAGGTGGCAGTGA TACCACTGCACTCCAGCTTAGGG
Strand - +
Off-target summary {0: 33, 1: 3229, 2: 56025, 3: 107913, 4: 145765} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!