|
Left Crispr |
Right Crispr |
Crispr ID |
1125225499 |
1125225502 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:37390717-37390739
|
15:37390734-37390756
|
Sequence |
CCTTCTTCACGTGGTGGCAGGAA |
CAGGAAAGACAGAATGAGGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 270, 2: 1186, 3: 1922, 4: 2569} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|