ID: 1125225499_1125225502

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1125225499 1125225502
Species Human (GRCh38) Human (GRCh38)
Location 15:37390717-37390739 15:37390734-37390756
Sequence CCTTCTTCACGTGGTGGCAGGAA CAGGAAAGACAGAATGAGGAGGG
Strand - +
Off-target summary {0: 11, 1: 270, 2: 1186, 3: 1922, 4: 2569} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!