ID: 1125430422_1125430428

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1125430422 1125430428
Species Human (GRCh38) Human (GRCh38)
Location 15:39588195-39588217 15:39588220-39588242
Sequence CCTGCAAGAAAGACGCCTGCCCC TAAGTGTGAGGTCCGCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122} {0: 1, 1: 0, 2: 1, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!