ID: 1125462135_1125462139

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1125462135 1125462139
Species Human (GRCh38) Human (GRCh38)
Location 15:39917594-39917616 15:39917630-39917652
Sequence CCAAAGTGTTGGGATTACAGGTG CAAGCCCAGCTGAACTTTTAAGG
Strand - +
Off-target summary {0: 5278, 1: 86308, 2: 220449, 3: 250032, 4: 194863} {0: 1, 1: 0, 2: 2, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!