ID: 1125612590_1125612596

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1125612590 1125612596
Species Human (GRCh38) Human (GRCh38)
Location 15:40981934-40981956 15:40981965-40981987
Sequence CCTTCCTCATTCTTCTCCTCCCT CAGACAGGCAACTTATCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 320, 4: 2754} {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!