ID: 1125630258_1125630264

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1125630258 1125630264
Species Human (GRCh38) Human (GRCh38)
Location 15:41141567-41141589 15:41141599-41141621
Sequence CCTGTAAGAGGTAAGAACTAACC CTTGCCTCTAAAGTCCAAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 38, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!