ID: 1125734228_1125734234

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125734228 1125734234
Species Human (GRCh38) Human (GRCh38)
Location 15:41912326-41912348 15:41912347-41912369
Sequence CCGCGTCCTGCCCTTCCTGGTGC GCGCCCTAAACAATAACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 441} {0: 1, 1: 0, 2: 1, 3: 5, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!