ID: 1125769631_1125769635

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1125769631 1125769635
Species Human (GRCh38) Human (GRCh38)
Location 15:42156492-42156514 15:42156509-42156531
Sequence CCCCCAGGAGGGGCAGCATCTTG ATCTTGTCTGCCAGCCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 247} {0: 1, 1: 0, 2: 0, 3: 9, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!