ID: 1125769631_1125769646

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1125769631 1125769646
Species Human (GRCh38) Human (GRCh38)
Location 15:42156492-42156514 15:42156543-42156565
Sequence CCCCCAGGAGGGGCAGCATCTTG AAAGCATGGCTGGGCAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 247} {0: 1, 1: 1, 2: 1, 3: 23, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!