ID: 1125827185_1125827187

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1125827185 1125827187
Species Human (GRCh38) Human (GRCh38)
Location 15:42686421-42686443 15:42686444-42686466
Sequence CCAGATTCCATGACAGAAGCATG TGAAGTCAAGCAGAACAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 191} {0: 1, 1: 0, 2: 2, 3: 17, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!