ID: 1125946026_1125946033

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125946026 1125946033
Species Human (GRCh38) Human (GRCh38)
Location 15:43712356-43712378 15:43712377-43712399
Sequence CCAGGGCCTGGATCTGAGATGGG GGGAAGGTTAGCTCGCACTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!