|
Left Crispr |
Right Crispr |
| Crispr ID |
1126140988 |
1126140995 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:45438532-45438554
|
15:45438572-45438594
|
| Sequence |
CCAGCCCTGGGCAACATGTGAAA |
ATAAAAAAATTAGCTGGGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 5, 3: 86, 4: 587} |
{0: 386, 1: 23583, 2: 61864, 3: 128471, 4: 163302} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|