ID: 1126140989_1126140995

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1126140989 1126140995
Species Human (GRCh38) Human (GRCh38)
Location 15:45438536-45438558 15:45438572-45438594
Sequence CCCTGGGCAACATGTGAAACCCT ATAAAAAAATTAGCTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 64, 4: 538} {0: 386, 1: 23583, 2: 61864, 3: 128471, 4: 163302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!