|
Left Crispr |
Right Crispr |
| Crispr ID |
1126140990 |
1126140993 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:45438537-45438559
|
15:45438566-45438588
|
| Sequence |
CCTGGGCAACATGTGAAACCCTG |
CAAAAAATAAAAAAATTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 131, 2: 393, 3: 1208, 4: 4211} |
{0: 313, 1: 8683, 2: 119993, 3: 115210, 4: 142125} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|