ID: 1126163495_1126163507

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1126163495 1126163507
Species Human (GRCh38) Human (GRCh38)
Location 15:45634860-45634882 15:45634911-45634933
Sequence CCTGGTTCTGTGCCCCGTGAGCG TGGTGCCTGGGCTGCGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 70} {0: 1, 1: 0, 2: 2, 3: 20, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!