ID: 1126163497_1126163515

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1126163497 1126163515
Species Human (GRCh38) Human (GRCh38)
Location 15:45634873-45634895 15:45634926-45634948
Sequence CCCGTGAGCGCTCAACGCCCTGG GGCGCCGGGCGGGGCACGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96} {0: 1, 1: 0, 2: 12, 3: 137, 4: 1078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!