ID: 1126558145_1126558149

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1126558145 1126558149
Species Human (GRCh38) Human (GRCh38)
Location 15:50013301-50013323 15:50013317-50013339
Sequence CCATAGCTCTTCTAGGGGGACAT GGGACATAGGATGGCCTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85} {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!