ID: 1126728333_1126728339

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1126728333 1126728339
Species Human (GRCh38) Human (GRCh38)
Location 15:51655589-51655611 15:51655603-51655625
Sequence CCCTGCCGGATCCGGAGGGATGG GAGGGATGGAAGTCAGCGGCAGG
Strand - +
Off-target summary No data {0: 39, 1: 126, 2: 141, 3: 117, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!