ID: 1126728338_1126728345 |
View in Genome Browser |
Spacer: 13 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1126728338 | 1126728345 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 15:51655600-51655622 | 15:51655636-51655658 |
Sequence | CCGGAGGGATGGAAGTCAGCGGC | CGGCAAACAGCAATGGTGGACGG |
Strand | - | + |
Off-target summary | {0: 22, 1: 88, 2: 109, 3: 75, 4: 146} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |