ID: 1126728338_1126728345

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1126728338 1126728345
Species Human (GRCh38) Human (GRCh38)
Location 15:51655600-51655622 15:51655636-51655658
Sequence CCGGAGGGATGGAAGTCAGCGGC CGGCAAACAGCAATGGTGGACGG
Strand - +
Off-target summary {0: 22, 1: 88, 2: 109, 3: 75, 4: 146} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!