ID: 1127256478_1127256486

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1127256478 1127256486
Species Human (GRCh38) Human (GRCh38)
Location 15:57297826-57297848 15:57297849-57297871
Sequence CCTGCCCGGGCTGACTGGGGGCC AGGATGCAGGGAAGGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 285} {0: 1, 1: 0, 2: 8, 3: 106, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!