ID: 1127410216_1127410225

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1127410216 1127410225
Species Human (GRCh38) Human (GRCh38)
Location 15:58697766-58697788 15:58697807-58697829
Sequence CCTGGACCTGCTAACACCAGTGC GGCCCAAGGACAGGCCCACTTGG
Strand - +
Off-target summary {0: 7, 1: 11, 2: 20, 3: 56, 4: 206} {0: 1, 1: 4, 2: 14, 3: 53, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!