ID: 1127433411_1127433423

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1127433411 1127433423
Species Human (GRCh38) Human (GRCh38)
Location 15:58933706-58933728 15:58933754-58933776
Sequence CCACCCTAGCGCAACCTGCAGCA CCGCGCGTGCGCGTTGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89} {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!