ID: 1127433413_1127433423

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1127433413 1127433423
Species Human (GRCh38) Human (GRCh38)
Location 15:58933710-58933732 15:58933754-58933776
Sequence CCTAGCGCAACCTGCAGCAGCAG CCGCGCGTGCGCGTTGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 222} {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!