ID: 1127570148_1127570156

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1127570148 1127570156
Species Human (GRCh38) Human (GRCh38)
Location 15:60233832-60233854 15:60233863-60233885
Sequence CCGAAATTGTACCATCGCACTCC CAACAGAGGGAGACTGTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 15, 2: 38, 3: 140, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!