ID: 1127570151_1127570156 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1127570151 | 1127570156 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:60233843-60233865 | 15:60233863-60233885 |
| Sequence | CCATCGCACTCCTGCCTGGGCAA | CAACAGAGGGAGACTGTCTCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 15, 2: 38, 3: 140, 4: 458} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||